LexA | LexA repressor
Product Sizes
20 ug
£482.00
AS214541P-20UG
About this Product
- SKU:
- AS214541P
- Application:
- Western Blot
- Extra Details:
- Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
- Format:
- Liquid, contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
- Formulation:
- Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE.
- Molecular Weight:
- 22.3 | 23 kDa
- Physical State:
- Liquid
- Purity:
- Over 90% pure by SDS-PAGE.
- Shipping Conditions:
- Blue Ice
- Storage Conditions:
- Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
- Supplier:
- Agrisera
- Type:
- Buffers & General Consumables:Others
