Anti-ssDNA/dsDNA [m3D8]
Product Sizes
200 ug
AB00347-1-1-200UG
About this Product
- SKU:
- AB00347-1-1
- Additional Names:
- single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA
- Application:
- ELISA, Surface Plasmon Resonance
- Buffer:
- PBS with 0.02% Proclin 300.
- translate.label.attr.clone:
- m3D8
- Clonality:
- Recombinant Monoclonal
- Formulation:
- PBS with 0.02% Proclin 300.
- Host:
- Mouse
- Immunogen:
- 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
- Isotype:
- IgG1
- Purification:
- Purified
- Reactivities:
- Wide/Non-species Specific
- Shipping Conditions:
- Blue Ice
- Specificity:
- Binds unspecifically to double- and single-stranded DNA oligomers.
- Storage Conditions:
- 2-8[o]C Aliquot., -20[o]C Aliquot. Avoid freeze/thaw cycles.
- Supplier:
- Absolute Antibody
- Type:
- Antibody: Recombinant Antibodies
- Manufacturer's Data Sheet:Ab00347-1.1
