ST20 cDNA

Size

£461.00

SKU:: 552302
Storage Conditions:: -20°C
Supplier:: United States Biological
Format:: Supplied as a lyophilized powder.
Extra Details:: cDNA Size: 240bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGCGATCTCGGCTCACTGCAACCTCTGTCTCCCAGGTTCAGGAAAATGGCTTTGTAAAGAAGCTTGAGCCTAAATCTGGCTGGATGACTTTTCTAGAAGTTACAGGAAAGATCTGTGAAATGCTCTTCTGTCCTGAAGCAATACTGTTGACCAGAAAGGACACTCCATATTGTGAAACCGGCCTAATTTTTCTGACTCTTACGAAAACGATTGCCAACACATACTTCTACTTTTAA Translation Sequence: MARSRLTATS VSQVQENGFV KKLEPKSGWM TFLEVTGKIC EMLFCPEAIL LTRKDTPYCE TGLIFLTLTK TIANTYFYF Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20°C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.