PCBD1 cDNA

Größe

£461.00

SKU:: 552152
Lagerbedingungen:: -20°C
Hersteller:: United States Biological
Format:: Supplied as a lyophilized powder.
Weitere Details:: PCBD1 encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. A deficiency of this enzyme leads to hyperphenylalaninemia. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 315bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTGGCAAAGCACACAGGCTGAGCGCTGAGGAGAGGGACCAGCTGCTGCCAAACCTGAGGGCTGTGGGGTGGAATGAGCTGGAAGGCCGTGATGCCATCTTCAAGCAGTTTCATTTCAAAGACTTCAACAGGGCCTTTGGGTTCATGACAAGAGTGGCCCTGCAGGCTGAGAAACTGGACCACCATCCTGAATGGTTTAACGTGTACAACAAGGTCCACATCACGCTGAGCACCCATGAGTGTGCCGGCCTTTCAGAACGGGACATAAACCTGGCCAGCTTCATCGAACAAGTAGCAGTGTCCATGACATAG Translation Sequence: MAGKAHRLSA EERDQLLPNL RAVGWNELEG RDAIFKQFHF KDFNRAFGFM TRVALQAEKL DHHPEWFNVY NKVHITLSTH ECAGLSERDI NLASFIEQVA VSMT Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20°C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.

Versandbedingungen:: Blue Ice