552104
NAA20 cDNA
Größe
£461.00
- SKU:
- 552104
- Lagerbedingungen:
- -20°C
- Hersteller:
- United States Biological
- Format:
- Supplied as a lyophilized powder.
- Weitere Details:
- NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N (alpha) -terminal acetylation of methionine residues when they are followed by asparagine. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 540bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACCACGCTACGGGCCTTTACCTGCGACGACCTGTTCCGCTTCAACAACATTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTCTACCTACAATACCTCGCCCACTGGCCAGAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAATTAATGGGTTATATTATGGGTAAAGCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGGCACGTCACAGCTCTGTCTGTTGCCCCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTTATGGAGTTACTAGAGGAGATTTCAGAAAGAAAGGGTGGATTTTTTGTGGATCTCTTTGTAAGAGTATCTAACCAAGTTGCAGTTAACATGTACAAGCAGTTGGGCTACAGTGTATATAGGACGGTCATAGAGTACTATTCGGCCAGCAACGGGGAGCCTGATGAGGACGCTTATGATATGAGGAAAGCACTTTCCAGGGATACTGAGAAGAAATCCATCATACCATTACCTCATCCTGTGAGGCCTGAAGACATTGAATAA Translation Sequence: MTTLRAFTCD DLFRFNNINL DPLTETYGIP FYLQYLAHWP EYFIVAEAPG GELMGYIMGKAEGSVAREEW HGHVTALSVA PEFRRLGLAA KLMELLEEIS ERKGGFFVDL FVRVSNQVAVNMYKQLGYSV YRTVIEYYSA SNGEPDEDAY DMRKALSRDT EKKSIIPLPH PVRPEDIE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20°C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
- Versandbedingungen:
- Blue Ice